WormMine: Gene WBGene00088861

• WormBase Gene ID: WBGene00088861
• Gene Name: CBG27447
• Sequence Name: CBG27447
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable 4 iron, 4 sulfur cluster binding activity. Predicted to be involved in Mo-molybdopterin cofactor biosynthetic process. Predicted to be part of molybdopterin synthase complex. Is an ortholog of C. elegans F49H6.5 and moc-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG27447.1	CBG27447.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG27447	CBG27447		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054299
• Remark: CBG16084, AAGGACAATTCGGGTTTATCAGCTCGATGTCGGATCATTTTTGTAATACATGCAATCGGT, WBGene00036147
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term