WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00119264 Gene Name  Cjp-atx-3
Sequence Name  ? CJA00060 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable cysteine-type deubiquitinase activity. Predicted to be involved in protein deubiquitination. Is an ortholog of C. elegans atx-3. In C. elegans, atx-3 is involved in chemical synaptic transmission. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00060b.1 CJA00060b.1   [unknown]
Transcript:CJA00060a.1 CJA00060a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00060a CJA00060a   [unknown]
CDS:CJA00060b CJA00060b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA08062, ATATGAACGATAGTGGATTTTTCTCGATTCAAGTGATTGAAAAGGCGCTGGACGCGTTTT, WBGene00127266   Expr1084721 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA00060, AAAGAGCCGAACATGGTGCAAAAGTTTTTCAATTCGGTTGGTCGACGACTTGGCGGAAGT, WBGene00119264   Expr1070351 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term