WormMine: Gene WBGene00119281

• WormBase Gene ID: WBGene00119281
• Gene Name: Cjp-aip-1
• Sequence Name: CJA00077
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable zinc ion binding activity. Is an ortholog of C. elegans aip-1. In C. elegans, aip-1 is involved in cellular response to misfolded protein and response to arsenic-containing substance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00077.1	CJA00077.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00077	CJA00077		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076953
• Remark: Cjp-aip-1, AATGTCGAAAAAAGGAGCTGGTGCCGATGGAGTGCTCGAAATGCCGGAGCAATTATTGTC, WBGene00119281
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term