WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00119698 Gene Name  CJA00494
Sequence Name  ? CJA00494 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable serine-type peptidase activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans eor-1. In C. elegans, eor-1 is involved in several processes, including determination of adult lifespan; nematode male tail tip morphogenesis; and signal transduction. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00494a.1 CJA00494a.1   [unknown]
Transcript:CJA00494c.1 CJA00494c.1   [unknown]
Transcript:CJA00494b.1 CJA00494b.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00494b CJA00494b   [unknown]
CDS:CJA00494a CJA00494a   [unknown]
CDS:CJA00494c CJA00494c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-eor-1, GAGAAGCCGTTCAAGTGCGATCAGTGTGAATATGCGTCGAGTCGGCGAGATAAGTTGAAG, WBGene00119698   Expr1072369 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term