WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00119734 Gene Name  CJA00530
Sequence Name  ? CJA00530 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Rab3GAP regulatory subunit; Rab3 GTPase-activating protein regulatory subunit C-terminus; and Rab3GAP regulatory subunit, C-terminal. Is an ortholog of C. elegans rbg-2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA00530.1 CJA00530.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA00530 CJA00530   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA00530, GAAGAATCCAAAGACGTGGCAAGAAGCGGTGACGTCACTCGGGCGGGCAGGTAATTCAGT, WBGene00119734   Expr1079312 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term