WormMine: Gene WBGene00120674

• WormBase Gene ID: WBGene00120674
• Gene Name: Cjp-pmp-1
• Sequence Name: CJA01470
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ABC-type transporter activity and ATP binding activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans pmp-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01470b.1	CJA01470b.1		[unknown]
Transcript:CJA01470a.1	CJA01470a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01470a	CJA01470a		[unknown]
CDS:CJA01470b	CJA01470b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073204
• Remark: CJA29085, AGCTCCAACTTCTAAATTCGACGGTAACATGCAAGAATATTTCTCCTGCGTTCTTCGGAA, WBGene00184659
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term