WormMine: Gene WBGene00120729

• WormBase Gene ID: WBGene00120729
• Gene Name: Cjp-egl-2
• Sequence Name: CJA01525
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable voltage-gated potassium channel activity. Predicted to be involved in potassium ion transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans egl-2. In C. elegans, egl-2 is involved in chemosensory behavior; egg-laying behavior; and muscle contraction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01525.1	CJA01525.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01525	CJA01525		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074875
• Remark: Cjp-egl-2, CAACAGCCGGCTCGCAAACTTGGAAAGGGTGTTGATAGGGCATAATGGTGGAGCCAACAC, WBGene00120729
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term