WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00120807 Gene Name  Cjp-amph-1
Sequence Name  ? CJA01603 Organism  Caenorhabditis japonica
Automated Description  Predicted to be located in cytoplasm. Is an ortholog of C. elegans amph-1. In C. elegans, amph-1 is involved in lipid tube assembly involved in organelle fission; nucleus localization; and nucleus organization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA01603b.1 CJA01603b.1   [unknown]
Transcript:CJA01603a.1 CJA01603a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA01603b CJA01603b   [unknown]
CDS:CJA01603a CJA01603a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-amph-1, GAGAAGAAGAGCCAGCTCCAAAACCGCTGGACGGCGTGACGACCGAAAAACGAAAGACGC, WBGene00120807   Expr1082664 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term