WormMine: Gene WBGene00121204

• WormBase Gene ID: WBGene00121204
• Gene Name: Cjp-dro-1
• Sequence Name: CJA02000
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable general transcription initiation factor activity and protein heterodimerization activity. Predicted to be involved in negative regulation of transcription by RNA polymerase II. Predicted to be part of negative cofactor 2 complex. Is an ortholog of C. elegans dro-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02000.1	CJA02000.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02000	CJA02000		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080656
• Remark: Cjp-dro-1, AAAACAATTTACCACGAGCACGTGCAGAAGGCTTTGCAGAATCTCGGTTTTCCAGCCGAC, WBGene00121204
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term