WormMine: Gene WBGene00121262

• WormBase Gene ID: WBGene00121262
• Gene Name: Cjp-abts-3
• Sequence Name: CJA02056
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable solute:inorganic anion antiporter activity. Predicted to be involved in monoatomic anion transport. Predicted to be located in membrane. Is an ortholog of C. elegans abts-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02056.1	CJA02056.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02056	CJA02056		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082482
• Remark: Cjp-abts-3, TGCGTGCCTTCTGCCAGCAATTGCATTCGGAGTTTTGAATGATGATAATACGAAAGGAGC, WBGene00121262
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term