WormMine: Gene WBGene00121340

• WormBase Gene ID: WBGene00121340
• Gene Name: Cjp-fozi-1
• Sequence Name: CJA02136
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in cytoskeleton organization and regulation of cell morphogenesis. Is an ortholog of C. elegans fozi-1. In C. elegans, fozi-1 is involved in mesodermal cell fate specification and positive regulation of mesodermal cell fate specification.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02136b.1	CJA02136b.1		[unknown]
Transcript:CJA02136a.1	CJA02136a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02136a	CJA02136a		[unknown]
CDS:CJA02136b	CJA02136b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080564
• Remark: Cjp-fozi-1, ACTCAAAACCACCATCGAAATGGACGAGACCGTCGACGAGCAGCACATTAATATTCTATC, WBGene00121340
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term