WormMine: Gene WBGene00121556

• WormBase Gene ID: WBGene00121556
• Gene Name: Cjp-myo-3
• Sequence Name: CJA02350
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity; actin filament binding activity; and cytoskeletal motor activity. Predicted to be part of myosin complex. Is an ortholog of C. elegans myo-3. In C. elegans, myo-3 is involved in locomotory behavior and positive regulation of ovulation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02350.1	CJA02350.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02350	CJA02350		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075964
• Remark: Cjp-myo-3, GTACAAGGTTCTCCAAGCCCAATTCGACCAGGCTGACGAGCGTGCCGAGATCGCCGAAAA, WBGene00121556
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term