WormMine: Gene WBGene00121904

• WormBase Gene ID: WBGene00121904
• Gene Name: Cjp-duo-1
• Sequence Name: CJA02700
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable cysteine-type deubiquitinase activity. Predicted to be involved in protein deubiquitination. Is an ortholog of C. elegans duo-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02700c.1	CJA02700c.1		[unknown]
Transcript:CJA02700a.1	CJA02700a.1		[unknown]
Transcript:CJA02700b.1	CJA02700b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02700b	CJA02700b		[unknown]
CDS:CJA02700a	CJA02700a		[unknown]
CDS:CJA02700c	CJA02700c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087303
• Remark: Cjp-duo-1, CATCAAGGCGACTCGCCGGACAAGGGTCACTACGTGGCATACACGAAAGATTTGTTCACC, WBGene00121904
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term