WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00122152 Gene Name  CJA02948
Sequence Name  ? CJA02948 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable ubiquitin-like modifier activating enzyme activity. Predicted to be involved in protein modification process. Is an ortholog of C. elegans uba-1. In C. elegans, uba-1 is involved in several processes, including developmental process involved in reproduction; negative regulation of transcription by RNA polymerase II; and programmed cell death involved in cell development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA02948a.1 CJA02948a.1   [unknown]
Transcript:CJA02948b.1 CJA02948b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA02948a CJA02948a   [unknown]
CDS:CJA02948b CJA02948b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA02948, GTGCGGTGAAGGAGGACTCATCAAAATTACCGACATGGATCAGATTGAGATTTCCAATCT, WBGene00122152   Expr1081986 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term