WormMine: Gene WBGene00122611

• WormBase Gene ID: WBGene00122611
• Gene Name: Cjp-srgp-1
• Sequence Name: CJA03407
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in signal transduction. Is an ortholog of C. elegans srgp-1. In C. elegans, srgp-1 is involved in negative regulation of cell migration; negative regulation of phagocytosis, engulfment; and regulation of cell-cell adhesion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03407.1	CJA03407.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03407	CJA03407		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088989
• Remark: Cjp-srgp-1, TTGGATCGAGTTCGTTGCGAGACCAGTTGAAACTGAAAGGAAGTCAGAATAACAATGGGG, WBGene00122611
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term