WormMine: Gene WBGene00122641

• WormBase Gene ID: WBGene00122641
• Gene Name: Cjp-snx-1
• Sequence Name: CJA03437
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable phosphatidylinositol binding activity. Is an ortholog of C. elegans snx-1. In C. elegans, snx-1 is involved in several processes, including mechanosensory behavior; protein localization to postsynaptic membrane; and vesicle-mediated transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03437.1	CJA03437.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03437	CJA03437		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085056
• Remark: Cjp-snx-1, TTTGACTCTGACCGGAAACAGGATATGAAAAACATGCTGGTTGAGTATATGGAGAGCATG, WBGene00122641
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term