WormMine: Gene WBGene00122969

• WormBase Gene ID: WBGene00122969
• Gene Name: Cjp-crn-3
• Sequence Name: CJA03765
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable 3'-5' exonuclease activity; nucleic acid binding activity; and nucleotide binding activity. Predicted to be involved in RNA processing. Predicted to be part of nuclear exosome (RNase complex). Is an ortholog of C. elegans crn-3. In C. elegans, crn-3 is involved in apoptotic DNA fragmentation and apoptotic cell clearance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03765.1	CJA03765.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03765	CJA03765		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080397
• Remark: Cjp-crn-3, AAGACAATAACGCTGATTTCGATCCGTTCCACCAGAAGTATCGCGTGAAGAACAAGTCGA, WBGene00122969
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term