WormMine: Gene WBGene00122989

• WormBase Gene ID: WBGene00122989
• Gene Name: Cjp-plx-2
• Sequence Name: CJA03785
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable semaphorin receptor activity. Predicted to be involved in semaphorin-plexin signaling pathway. Is an ortholog of C. elegans plx-2. In C. elegans, plx-2 is involved in several processes, including axonal fasciculation; nematode larval development; and nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03785.1	CJA03785.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03785	CJA03785		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081501
• Remark: Cjp-plx-2, TGAAGCAAGTCACCAACGACTTCCGCAAAAGTTGTCACAGGTTCTTCACGTTTGTTTAGA, WBGene00122989
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term