WormMine: Gene WBGene00123263

• WormBase Gene ID: WBGene00123263
• Gene Name: CJA04059
• Sequence Name: CJA04059
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable deoxyribose-phosphate aldolase activity. Predicted to be involved in deoxyribonucleotide catabolic process. Predicted to be located in cytoplasm. Is an ortholog of C. elegans F09E5.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA04059.1	CJA04059.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA04059	CJA04059		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084334
• Remark: CJA04059, ATGTGCACTGCGGTGAAAAGATGGCATGAGTTGACGGGCAAGAAAGTTGGATTCAAGCCA, WBGene00123263
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term