WormMine: Gene WBGene00124637

• WormBase Gene ID: WBGene00124637
• Gene Name: Cjp-pat-4
• Sequence Name: CJA05433
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable protein kinase activity. Is an ortholog of C. elegans pat-4. In C. elegans, pat-4 is involved in several processes, including integrin-mediated signaling pathway; muscle cell cellular homeostasis; and positive regulation of supramolecular fiber organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05433.1	CJA05433.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05433	CJA05433		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072851
• Remark: Cjp-pat-4, AAACTCTCCATGGCAGACACGAAATTCTCATTCCAAGAGGTTGGCAAAGCGTACTCACCA, WBGene00124637
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term