WormMine: Gene WBGene00124946

• WormBase Gene ID: WBGene00124946
• Gene Name: Cjp-rab-37
• Sequence Name: CJA05742
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Is an ortholog of C. elegans rab-37.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05742a.1	CJA05742a.1		[unknown]
Transcript:CJA05742b.1	CJA05742b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05742b	CJA05742b		[unknown]
CDS:CJA05742a	CJA05742a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089733
• Remark: Cjp-rab-37, TACAGTATCCCTTTCATGGAAACGAGTGCGAAGACTGGGTACAACGTGGATAGAGCGTTT, WBGene00124946
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term