WormMine: Gene WBGene00125082

• WormBase Gene ID: WBGene00125082
• Gene Name: Cjp-ltah-1.2
• Sequence Name: CJA05878
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable metallopeptidase activity and zinc ion binding activity. Predicted to be involved in proteolysis. Is an ortholog of C. elegans ltah-1.2. In C. elegans, ltah-1.2 is involved in negative regulation of fatty acid transport; regulation of lipid storage; and regulation of peptide transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05878a.1	CJA05878a.1		[unknown]
Transcript:CJA05878b.1	CJA05878b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05878b	CJA05878b		[unknown]
CDS:CJA05878a	CJA05878a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070748
• Remark: CJA05878, AAATGGGAGGCTTGCATCCCAAAAGCTCTTGACTTTGTGAACTCTCAAGGTCGTCTCAAA, WBGene00125082
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term