WormMine: Gene WBGene00125246

• WormBase Gene ID: WBGene00125246
• Gene Name: Cjp-vab-1
• Sequence Name: CJA06042
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and ephrin receptor activity. Predicted to be involved in cell surface receptor protein tyrosine kinase signaling pathway. Predicted to be located in plasma membrane. Is an ortholog of C. elegans vab-1. In C. elegans, vab-1 is involved in several processes, including cell development; embryonic morphogenesis; and regulation of axon guidance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06042.1	CJA06042.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06042	CJA06042		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091162
• Remark: Cjp-vab-1, CAGAGTACACGACAAACGGCGGAAAAATTCCGGTCAGATGGACAGCTCCAGAAGCCATCA, WBGene00125246
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term