WormMine: Gene WBGene00125309

• WormBase Gene ID: WBGene00125309
• Gene Name: Cjp-lipl-1
• Sequence Name: CJA06105
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable hydrolase activity, acting on ester bonds. Predicted to be involved in lipid metabolic process. Is an ortholog of C. elegans lipl-1. In C. elegans, lipl-1 is involved in lipid catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06105.1	CJA06105.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06105	CJA06105		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084621
• Remark: CJA06105, CAAGGATGTTTACGAGCCGATCATAGAAATTGTGAGAGATGATGTGCTCAACGGTTCATA, WBGene00125309
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term