WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00125406 Gene Name  CJA06202
Sequence Name  ? CJA06202 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable protein dimerization activity. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA06202c.1 CJA06202c.1   [unknown]
Transcript:CJA06202b.1 CJA06202b.1   [unknown]
Transcript:CJA06202a.1 CJA06202a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA06202a CJA06202a   [unknown]
CDS:CJA06202c CJA06202c   [unknown]
CDS:CJA06202b CJA06202b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA07924, AGCTGAACGACTATTTTCGTCAGCAAAAACGGTTCTCACCGATAACCGCAAACTTCTGAG, WBGene00127128   Expr1084195 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term