WormMine: Gene WBGene00125710

• WormBase Gene ID: WBGene00125710
• Gene Name: Cjp-mpk-1
• Sequence Name: CJA06506
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and MAP kinase activity. Is an ortholog of C. elegans mpk-1. In C. elegans, mpk-1 is involved in several processes, including determination of adult lifespan; intracellular signaling cassette; and positive regulation of nitrogen compound metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA06506a.1	CJA06506a.1		[unknown]
Transcript:CJA06506b.1	CJA06506b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA06506a	CJA06506a		[unknown]
CDS:CJA06506b	CJA06506b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080699
• Remark: Cjp-mpk-1, AAGAACCGTTCACCCTCGAAATGGAATTTGACGATCTTCCGAAAGAGAAGCTGAAGGAAC, WBGene00125710
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term