WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00126114 Gene Name  CJA06910
Sequence Name  ? CJA06910 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: NagB/RpiA transferase-like; Initiation factor 2 subunit family; Initiation factor 2B-like, C-terminal; Initiation factor 2B-related; and Initiation factor 2B alpha/beta/delta. Is an ortholog of C. elegans C01G10.9. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA06910a.1 CJA06910a.1   [unknown]
Transcript:CJA06910b.1 CJA06910b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA06910a CJA06910a   [unknown]
CDS:CJA06910b CJA06910b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA06910, GTTCACGTCCATAAATCGGAAAATCGCGTCCGGAGATGAGATACGAATCGAAGAGCGGCC, WBGene00126114   Expr1084297 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA23551, AGATGTCGCAGTTAGGTTCGGAAGACGTGAAACAGAAAATTGCGTACCTGATCAGTTCTC, WBGene00179123   Expr1090738 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term