WormMine: Gene WBGene00127044

• WormBase Gene ID: WBGene00127044
• Gene Name: Cjp-gcn-2
• Sequence Name: CJA07840
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and eukaryotic translation initiation factor 2alpha kinase activity. Predicted to be involved in DNA damage checkpoint signaling. Is an ortholog of C. elegans gcn-2. In C. elegans, gcn-2 is involved in several processes, including determination of adult lifespan; positive regulation of protein modification process; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07840.1	CJA07840.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07840	CJA07840		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076719
• Remark: Cjp-gcn-2, GGAGCACAGCAAACTCGATTTGGTTTCCCTTCGCAAGCAACTTCGCTCAACTGTCAGCAA, WBGene00127044
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term