WormMine: Gene WBGene00127100

• WormBase Gene ID: WBGene00127100
• Gene Name: CJA07896
• Sequence Name: CJA07896
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans scd-2. In C. elegans, scd-2 is involved in dauer larval development; sensory perception of chemical stimulus; and sensory processing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07896b.1	CJA07896b.1		[unknown]
Transcript:CJA07896a.1	CJA07896a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07896b	CJA07896b		[unknown]
CDS:CJA07896a	CJA07896a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083437
• Remark: Cjp-scd-2, GCCTCTTGTCAATACCGAAACTTTACGTCCGAGCCGTTTTGCATGTGCAACAATGGAAAA, WBGene00127100
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term