WormMine: Gene WBGene00127751

• WormBase Gene ID: WBGene00127751
• Gene Name: Cjp-mdt-19
• Sequence Name: CJA08547
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable transcription coregulator activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be part of mediator complex. Is an ortholog of C. elegans mdt-19.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08547.1	CJA08547.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08547	CJA08547		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086138
• Remark: Cjp-mdt-19, TACGATGCGTATGGATACGAGGAGGACGAGACTGAAAAGGGTTTCCCGAAAAAGCACAAG, WBGene00127751
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term