WormMine: Gene WBGene00128084

• WormBase Gene ID: WBGene00128084
• Gene Name: CJA08882
• Sequence Name: CJA08882
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable calmodulin-lysine N-methyltransferase activity and protein heterodimerization activity. Predicted to be located in cytoplasm. Predicted to be part of FANCM-MHF complex. Is an ortholog of C. elegans Y48E1C.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08882b.1	CJA08882b.1		[unknown]
Transcript:CJA08882c.1	CJA08882c.1		[unknown]
Transcript:CJA08882a.1	CJA08882a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08882a	CJA08882a		[unknown]
CDS:CJA08882b	CJA08882b		[unknown]
CDS:CJA08882c	CJA08882c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1087480
• Remark: CJA07126, ACGCCTGGAAAGACGAACACGAGCGCGATGAAAAATTTCCTGTGATTTTGACAATTTCGC, WBGene00126330
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term