WormMine: Gene WBGene00128434

• WormBase Gene ID: WBGene00128434
• Gene Name: Cjp-tat-1.2
• Sequence Name: CJA09230
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP hydrolysis activity; ATPase-coupled intramembrane lipid transporter activity; and small molecule binding activity. Predicted to be involved in phospholipid transport. Predicted to be located in membrane. Is an ortholog of C. elegans tat-1. In C. elegans, tat-1 is involved in several processes, including lysosome organization; phospholipid translocation; and regulation of phagocytosis, engulfment.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09230.1	CJA09230.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09230	CJA09230		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073836
• Remark: Cjp-tat-1, TCCTCTACTCGTTCTACAAAAACATTTGTCTGTACATTATCGAACTGTGGTTTGCAATCT, WBGene00128434
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

8 GO Annotation

0 Homologues

0 Locations

8 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term