WormMine: Gene WBGene00128679

• WormBase Gene ID: WBGene00128679
• Gene Name: Cjp-nfki-1
• Sequence Name: CJA09474
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans nfki-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09474b.1	CJA09474b.1		[unknown]
Transcript:CJA09474a.1	CJA09474a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09474b	CJA09474b		[unknown]
CDS:CJA09474a	CJA09474a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083454
• Remark: CJA09474, ATCTACTGGCAAAAACGTAGTACATTATGCTGTCGACAAAATGGATGTTCAACTTCTGGA, WBGene00128679
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term