WormMine: Gene WBGene00128797

• WormBase Gene ID: WBGene00128797
• Gene Name: Cjp-tyr-5
• Sequence Name: CJA09593
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable oxidoreductase activity. Is an ortholog of C. elegans tyr-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09593a.1	CJA09593a.1		[unknown]
Transcript:CJA09593b.1	CJA09593b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09593a	CJA09593a		[unknown]
CDS:CJA09593b	CJA09593b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079844
• Remark: Cjp-tyr-5, GACGAACGAAGATCAGCCGCCAACATGTGTGAGCAAAGTGCGTCGCAACGGCTCCTGTCA, WBGene00128797
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term