WormMine: Gene WBGene00128894

• WormBase Gene ID: WBGene00128894
• Gene Name: CJA09690
• Sequence Name: CJA09690
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in ubiquitin-dependent protein catabolic process via the N-end rule pathway. Is an ortholog of C. elegans F10G7.10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09690a.1	CJA09690a.1		[unknown]
Transcript:CJA09690b.1	CJA09690b.1		[unknown]
Transcript:CJA09690c.1	CJA09690c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09690a	CJA09690a		[unknown]
CDS:CJA09690c	CJA09690c		[unknown]
CDS:CJA09690b	CJA09690b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081963
• Remark: CJA09690, AAAAGAGCGCAATGACGATGCAAAAGTTGATGGCAAGCGAGGGAATGTCGGCCGCCGAGG, WBGene00128894
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term