WormMine: Gene WBGene00129069

• WormBase Gene ID: WBGene00129069
• Gene Name: Cjp-ercc-1
• Sequence Name: CJA09865
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable damaged DNA binding activity. Predicted to be involved in DNA repair. Predicted to be located in nucleus. Is an ortholog of C. elegans ercc-1. In C. elegans, ercc-1 is involved in UV-damage excision repair and base-excision repair.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09865a.1	CJA09865a.1		[unknown]
Transcript:CJA09865b.1	CJA09865b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09865b	CJA09865b		[unknown]
CDS:CJA09865a	CJA09865a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091027
• Remark: CJA09865, AACATGATTTGCTTTAGAGAGGCGTGGACTCTTGTTGTGGTTTACACGGTAAATATGCAA, WBGene00129069
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term