WormMine: Gene WBGene00129326

• WormBase Gene ID: WBGene00129326
• Gene Name: Cjp-vps-18
• Sequence Name: CJA10122
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be involved in intracellular protein transport and vesicle-mediated transport. Is an ortholog of C. elegans vps-18. In C. elegans, vps-18 is involved in endosome organization and phagosome-lysosome fusion involved in apoptotic cell clearance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10122.1	CJA10122.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10122	CJA10122		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088575
• Remark: Cjp-vps-18, TTGAGCCGGATGCTCTGGAAATTGTGCTCAGAAAACAAGCGGATTTTTACATTCATGAGA, WBGene00129326
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term