WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00129587 Gene Name  Cjp-ttll-5
Sequence Name  ? CJA10383 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable ATP binding activity. Predicted to be involved in protein modification process. Is an ortholog of C. elegans ttll-5. In C. elegans, ttll-5 is involved in response to hermaphrodite contact. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA10383a.1 CJA10383a.1   [unknown]
Transcript:CJA10383b.1 CJA10383b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA10383a CJA10383a   [unknown]
CDS:CJA10383b CJA10383b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA18116, ATTGCGTGGTGTCTCAAGAGAGCAGAGATGCTGTTCAAATGCGTCAAAGGTTACTTGATG, WBGene00137320   Expr1080985 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-ttll-5, AAAATCACGCAGGAGGGAGAGACGTATGCTGCAAAACTGCCAGTTATCAGAGCGACGGCA, WBGene00129587   Expr1087928 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  involved_in
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term