WormMine: Gene WBGene00129757

• WormBase Gene ID: WBGene00129757
• Gene Name: Cjp-myrf-1
• Sequence Name: CJA10553
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity and DNA-binding transcription factor activity. Predicted to be involved in protein autoprocessing and regulation of DNA-templated transcription. Is an ortholog of C. elegans myrf-1. In C. elegans, myrf-1 is involved in ecdysis, collagen and cuticulin-based cuticle and nematode larval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10553.1	CJA10553.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10553	CJA10553		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085860
• Remark: Cjp-pqn-47, GAAAGTTGTTCCAGTGATGAGGCCAACGGATTGTACGAGGAGTACAATTTGATCTTTTAT, WBGene00129757
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term