WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00129898 Gene Name  Cjp-lex-1
Sequence Name  ? CJA10694 Organism  Caenorhabditis japonica
Automated Description  Predicted to enable ATP binding activity and ATP hydrolysis activity. Is an ortholog of C. elegans lex-1. In C. elegans, lex-1 is involved in regulation of heterochromatin formation. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA10694a.1 CJA10694a.1   [unknown]
Transcript:CJA10694b.1 CJA10694b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA10694b CJA10694b   [unknown]
CDS:CJA10694a CJA10694a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA26175, TCCACCATCAGGAATTGCCCAACAAGAATTGATAATTTCGCGAGATGCCATAGATGACGT, WBGene00181747   Expr1091699 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-lex-1, CGATTGATGAGTGGATTAAAGTTATTCCTGTATCAGTTCAACACATGCTCATCACATGCC, WBGene00129898   Expr1089645 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

2 GO Annotation

Annotation Extension Qualifier
  enables
  enables

0 Homologues

0 Locations

2 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term