WormMine: Gene WBGene00129958

• WormBase Gene ID: WBGene00129958
• Gene Name: Cjp-pfkb-1.1
• Sequence Name: CJA10754
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable 6-phosphofructo-2-kinase activity and ATP binding activity. Predicted to be involved in fructose 2,6-bisphosphate metabolic process and fructose metabolic process. Is an ortholog of C. elegans pfkb-1.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10754.1	CJA10754.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10754	CJA10754		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079375
• Remark: CJA10754, TACCAACCAGAATCGCGACGATTTGCCATACTTGAAAGTACCGCTTCACACTGTCATAAA, WBGene00129958
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term