WormMine: Gene WBGene00131077

• WormBase Gene ID: WBGene00131077
• Gene Name: Cjp-tbx-38
• Sequence Name: CJA11873
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA-binding transcription factor activity and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans tbx-38. In C. elegans, tbx-38 is involved in pharynx development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11873.1	CJA11873.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11873	CJA11873		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074935
• Remark: CJA11873, AGCGAAGCAATGATTGCATTGAAAGTGTCGCACAACAAATTTGCGTCCGGTTTCCGATCG, WBGene00131077
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term