WormMine: Gene WBGene00131335

• WormBase Gene ID: WBGene00131335
• Gene Name: Cjp-him-1
• Sequence Name: CJA12131
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity and ATP hydrolysis activity. Predicted to be involved in chromosome organization. Predicted to be located in chromosome. Is an ortholog of C. elegans him-1. In C. elegans, him-1 is involved in chromosome segregation; embryo development; and response to radiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12131.1	CJA12131.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12131	CJA12131		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088135
• Remark: Cjp-him-1, TGCTCACTTTTGATCTTACTCGCTATAAACAGATTGGACTCAACGAAATGACGGACAATC, WBGene00131335
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term