WormMine: Gene WBGene00131338

• WormBase Gene ID: WBGene00131338
• Gene Name: Cjp-cdf-1
• Sequence Name: CJA12134
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable monoatomic cation transmembrane transporter activity. Predicted to be involved in monoatomic cation transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans cdf-1. In C. elegans, cdf-1 is involved in cellular response to zinc ion; positive regulation of Ras protein signal transduction; and positive regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12134a.1	CJA12134a.1		[unknown]
Transcript:CJA12134b.1	CJA12134b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12134b	CJA12134b		[unknown]
CDS:CJA12134a	CJA12134a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079966
• Remark: Cjp-cdf-1, CCGGCTATTTTCACCGATGCTGCTTTCACAATCAAAAAGTATTTTCATGACATGGGAGTG, WBGene00131338
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term