WormMine: Gene WBGene00131772

• WormBase Gene ID: WBGene00131772
• Gene Name: Cjp-ugt-5
• Sequence Name: CJA12568
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable UDP-glycosyltransferase activity and peptidyl-prolyl cis-trans isomerase activity. Is an ortholog of C. elegans ugt-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12568a.1	CJA12568a.1		[unknown]
Transcript:CJA12568b.1	CJA12568b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12568b	CJA12568b		[unknown]
CDS:CJA12568a	CJA12568a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085071
• Remark: Cjp-fkb-4, GCGGAGCCAAGCTGTTCTTTGAAATTGTTCTCGAAAAGTTGGTGAAACGGGATGAGTTGT, WBGene00126753
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term