WormMine: Gene WBGene00132021

• WormBase Gene ID: WBGene00132021
• Gene Name: Cjp-catp-5
• Sequence Name: CJA12817
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable ATP binding activity; ATP hydrolysis activity; and P-type transmembrane transporter activity. Predicted to be located in membrane. Is an ortholog of C. elegans catp-5. In C. elegans, catp-5 is involved in polyamine transmembrane transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12817b.1	CJA12817b.1		[unknown]
Transcript:CJA12817c.1	CJA12817c.1		[unknown]
Transcript:CJA12817a.1	CJA12817a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12817a	CJA12817a		[unknown]
CDS:CJA12817b	CJA12817b		[unknown]
CDS:CJA12817c	CJA12817c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1088195
• Remark: Cjp-catp-5, CACATCCTATGCAGTGTCTAAATATATGGCCGCTTATTCGTTAAACGAATTCTTGTCCGT, WBGene00132021
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term