WormMine: Gene WBGene00132053

• WormBase Gene ID: WBGene00132053
• Gene Name: Cjp-snf-8
• Sequence Name: CJA12849
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be located in membrane. Is an ortholog of C. elegans snf-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12849d.1	CJA12849d.1		[unknown]
Transcript:CJA12849b.1	CJA12849b.1		[unknown]
Transcript:CJA12849c.1	CJA12849c.1		[unknown]
Transcript:CJA12849a.1	CJA12849a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12849a	CJA12849a		[unknown]
CDS:CJA12849b	CJA12849b		[unknown]
CDS:CJA12849c	CJA12849c		[unknown]
CDS:CJA12849d	CJA12849d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073403
• Remark: Cjp-snf-8, CAAATCTACCTGGACATTTATGCGTTGATGAGACCTCCAGGAAATTGGAATCGTTTTTAC, WBGene00132053
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term