WormMine: Gene WBGene00132098

• WormBase Gene ID: WBGene00132098
• Gene Name: CJA12894
• Sequence Name: CJA12894
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity and fucosyltransferase activity. Predicted to be involved in DNA integration; DNA recombination; and protein glycosylation. Predicted to be located in membrane. Is an ortholog of C. elegans C27D9.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA12894b.1	CJA12894b.1		[unknown]
Transcript:CJA12894a.1	CJA12894a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA12894a	CJA12894a		[unknown]
CDS:CJA12894b	CJA12894b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1078287
• Remark: CJA12894, ACTTTCGTTTGTTTACATTTGGAATCACAGAAGATGACGTCAAGGACCAAGTGGAGGTAA, WBGene00132098
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

6 GO Annotation

0 Homologues

0 Locations

6 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term