WormMine: Gene WBGene00132868

• WormBase Gene ID: WBGene00132868
• Gene Name: Cjp-eif-2Bbeta
• Sequence Name: CJA13664
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Initiation factor 2B-like, C-terminal; NagB/RpiA transferase-like; Initiation factor 2 subunit family; and Initiation factor 2B-related. Is an ortholog of C. elegans eif-2Bbeta.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13664b.1	CJA13664b.1		[unknown]
Transcript:CJA13664a.1	CJA13664a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13664a	CJA13664a		[unknown]
CDS:CJA13664b	CJA13664b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075273
• Remark: CJA13664, TTGCATTATTCCGTCGCATGTCAATCGGCTCAAAGAGGACTATTATCATTCGCAGGATAT, WBGene00132868
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term