WormMine: Gene WBGene00133316

• WormBase Gene ID: WBGene00133316
• Gene Name: Cjp-eef-1B.1
• Sequence Name: CJA14112
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable translation elongation factor activity. Predicted to be involved in translational elongation. Is an ortholog of C. elegans eef-1B.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14112.1	CJA14112.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14112	CJA14112		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071065
• Remark: CJA14112, GAATCAAGAAGCTCCAGATTATCGTCGTTGTCGAGGATCTTAAGGTTTCTGTCGATGATC, WBGene00133316
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term